Ch.17 - Gene ExpressionSee all chapters
All Chapters
Ch.1 - Introduction to Biology
Ch.2 - Chemistry
Ch.3 - Water
Ch.4 - Carbon
Ch.5 - Biological Molecules
Ch.6 - Cells
Ch.7 - The Membrane
Ch.8 - Energy and Metabolism
Ch.9 - Respiration
Ch.10 - Photosynthesis
Ch.11 - Cell Signaling
Ch.12 - Cell Division
Ch.13 - Meiosis
Ch.14 - Mendelian Genetics
Ch.15 - Chromosomal Theory of Inheritance
Ch.16 - DNA Synthesis
Ch.17 - Gene Expression
Ch.18 - Regulation of Expression
Ch.19 - Viruses
Ch.20 - Biotechnology
Ch.21 - Genomics
Ch.22 - Development
Ch.23 - Evolution by Natural Selection
Ch.24 - Evolution of Populations
Ch.25 - Speciation
Ch.26 - History of Life on Earth
Ch.27 - Phylogeny
Ch.28 - Prokaryotes
Ch.29 - Protists
Ch.30 - Plants
Ch.31 - Fungi
Ch.32 - Overview of Animals
Ch.33 - Invertebrates
Ch.34 - Vertebrates
Ch.35 - Plant Anatomy
Ch.36 - Vascular Plant Transport
Ch.37 - Soil
Ch.38 - Plant Reproduction
Ch.39 - Plant Sensation and Response
Ch.40 - Animal Form and Function
Ch.41 - Digestive System
Ch.42 - Circulatory System
Ch.43 - Immune System
Ch.44 - Osmoregulation and Excretion
Ch.45 - Endocrine System
Ch.46 - Animal Reproduction
Ch.47 - Nervous System
Ch.48 - Sensory Systems
Ch.49 - Muscle Systems
Ch.50 - Ecology
Ch.51 - Animal Behavior
Ch.52 - Population Ecology
Ch.53 - Community Ecology
Ch.54 - Ecosystems
Ch.55 - Conservation Biology

Translation

See all sections
Sections
Gene Expression and the Genetic Code
Transcription
RNA Processing
Translation
Mutation

Concept #1: tRNA, Anticodons, and The Wobble Hypothesis

Concept #4: Post-Translational Modifications and Protein Targetting

Additional Problems
All of the following are directly involved in translation EXCEPT: a. mRNA b. tRNA c. ribosomes d. DNA
The process by which cells use the information of RNA molecules to make proteins is transcription.  a. True b. False
There are only two main types of RNA needed to make proteins. They are tRNA and rRNA.  a. True b. False
The type of RNA that delivers amino acids to the ribosome during protein synthesis is tRNA. a. True b. False
A particular triplet of bases in the DNA is ATC. The corresponding triplet on the anti-codon is: a. ATC  b. UTC c. TAG d. UTG e. AUC
Draw a simple diagram showing where transcription, RNA modification/splicing, and translation occur in the cell.
Write the base sequence and indicate the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences.5'AAAAGGAA3'5'GGGGGAT3'5'GGGGCCCC3'5'CGCGATGCCG3'Provide the amino acid corresponding to each of the following codons.AGUGUUUUC
A tRNA anticodon is 5' GAA 3'. Answer the following questions.Which one of the following codons is recognized by this tRNA?a. 5' UUC 3'b. 5' CTT 3'c. 5' CUU 3'd. 5' TTC 3'The first base at the 5' end of the anticodon has relaxed base-pairing rules allowing some tRNAs to bind multiple codon sequences. This is called the third base "wobble" hypothesis. How many codons could a tRNA with the anticodon 5'-GAA-3' recognize? Enter your answer as a whole number.Which amino acid does this tRNA carry?a. Glutamic Acidb. Phenylalaninec. Lysined. Leucine
Protein Synthesis Worksheet:
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA.
A. Replication          B. Transcription          C. Post-transcriptional processing         D. Translation          E. Post-translational processing          F. Respiration          G. Photosynthesis For each description below, select the one best word or phrase from the list above and place the corresponding letter in provided space. Words at right may be used more than once.i. ___ utilizes RNA polymerase.ii. ___ adds a modified-G cap.iii. ___ requires the enzyme hexokinase.iv. ___ utilized spliceosomes or ribozymes.v. ___ includes cyclic photophosphorylation.vi. ___ includes careful proofreading to correct any errors.vii. ___ uses an RNA primer to produce a lagging strand.viii. ___ removal of a peptide fragment for pro-insulin.ix. ___ function of an operon.x. ___ may use a chaperonin.xi. ___ removal of introns.xii. ___ CAM is a variation of it. xiii. ___ occurs on ribosomes.xiv. ____ utilizes acetyl-CoA (C2-CoA).
Transcription and Translation Worksheet 1. The DNA sequence 5’-T T A A C G G C T T T T T T C G T A C A T-3’ was used as a template to synthesize a molecule of mRNA that was then translated into protein.A. Give the sequence of each of the following AND indicate the 5’ and 3’ ends of each.DNA coding strand –DNA template strand –mRNA sequence –B. Translate your mRNA molecule into a polypeptide chain using the genetic code.C. Indicate the C-terminal amino acid and the N-terminal amino acid of the resulting polypeptide.
The type of RNA that carries the information that specifies a protein is:  a. Transfer RNA b. Ribosomal RNA c. Messenger RNA d. Double-stranded RNA e. Complementary RNA
The type of RNA that carries each amino acid to the ribosome is:  a. Complementary RNA b. Messenger RNA c. Ribosomal RNA d. Double-stranded RNA e. Transfer RNA
The process used by cells to convert the mRNA "message" into a sequence of amino acids is:  a. Transcription b. Replication c. Mitosis d. Amino acid synthesis e. Translation
A three base sequence (loop) in tRNA that is complementary to a sequence of three bases in mRNA is:  a. A codon b. An anticodon c. A promoter d. A terminator e. An amino acid attachment site
The step of translation in which an mRNA, a small ribosomal subunit, and the initiator tRNA are aligned together is:  a. Initiation b. Mitosis c. Elongation d. Termination e. Transcription
The step of translation in which amino acids are added one at a time to the growing polypeptide is:  a. Mitosis b. Initiation c. Elongation d. Termination e. Transcription
The step of translation in which release factors bind to a stop codon is:  a. Mitosis b. Termination c. Initiation d. Elongation e. Transcription
Which of the following does not occur during translation's termination step?  a. The initiator tRNA brings the amino acid methionine b. Ribosomal subunits separate from each other c. The polypeptide is released d. A "stop" codon is reached by the ribosome e. Release factors bind to the stop codon
When is a peptide bond formed during the process of translation?a. During the elongation phase just after a tRNA charged with an amino acid binds to the A site on the ribosomeb. During the termination phase just after a release factor binds to the A site on the ribosomec. During the elongation phase just after a tRNA that has lost its amino acid exits the E site on the ribosome
What would be the first codon translated in the mRNA sequence 5' – GGAAUGAAACAGGAACCC – 3'?  a. GGA b. CCC c. AUG d. GAA e. AAU
What is translation?
What is the function of a smaller subunit and large subunit of ribosomes?
What are the differences between transcription and replication?
What are the functions of ribosomes, mRNA, rRNA and tRNA during translation?
 Is protein synthesis the same in Prokaryotes and Eukaryotes?
What are the roles for Release factors and Elongation factors during translation?
One strand ofa section of DNA isolated from E. coli reads:5' - GCA TAT GGC CTC CTC CGA GGA CGT CAT CAA - 3'A. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What is the sequence of the mRNA? Write the sequence such that it reads 5' → 3' from left to right.B. Disregarding translational start sites, write the sequences of the three longest polypeptides that would be made from this mRNA. Use three-letter abbreviations for individual amino acids.
Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of this mRNA molecule into protein.5' - UAUGAUACUGCUAUCUAGGACU - 3'A. 5' - UAG - 3'B. 5' - GAU - 3'C. 5' - CAG - 3'D. 5' - GAC - 3'
When does translation stop? What molecule comes into the A site to stop translation?
The genetic code has many important characteristics. For example, a specific codon always means the same thing in a particular species. Codons mean the same thing in most species (even though there are some exceptions). In some cases, a particular amino acid can be specified by more than one codon (The genetic code is degenerate). Which of the following answers describes an example of the degenerate nature of the code?A. AUU codes for Ile in a wide variety of species.B. There are no pauses or commas in the code.C. The sequence "AUGCCGAUU" is read as three codons, AUG, then CCG, then AUU.D. AUU, AUC, and AUA code for Ile.
Below is an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of the table with the appropriate nucleotide/amino acid based on the information provided.
In translation, the ribosome scans the mRNA first until it reaches _____?A. The P site on the ribosomeB. a start codonC. the promoter regionD. a tRNA molecule
What is a promoter and what are the important sequences within a promoter?
Which of the following is true of the trafficking of proteins from the cytosol to the endoplasmic reticulum?A. The proteins are first completely synthesized in the cytosol.B. The signal recognition particle (SRP) does not enter the ER lumen.C. The polypeptide signal sequence is cleaved by the peptide translocation complex.D. The SRP receptor faces the ER lumen side of the ER membrane.
RNAse is a protein that is present in our cells and it has 104 residues (amino acids). The cDNA for this protein has approximately ____ nucleotides.A. ~104 nucleotidesB. ~312 nucleotidesC. ~930 nucleotidesD. less than 300 nucleotidesE. None of the above
Which of the following statements concerning ribosomes are true?A. Several ribosomes are often attached to and translating the same mRNA.B. Ribosomes join amino acids to form a polypeptide.C. Ribosomes have a binding site for mRNA and three binding site for tRNA molecules.D.  No protein synthesis within a cell would occur without ribosomes.E. All of the above statements are true.
Which molecule acts as an enzyme during the formation of peptide bonds between amino acids?A. Large ribosomal subunitB. Transfer RNAC. Messenger RNAD. Small ribosomal subunit
Which of the following is a TRUE statement about geneexpression in prokaryotes?A. Gene expression includes transcription, but not translation.B. Transcription occurs in the nucleus, but not translation.C. There is no editing of transcripts after transcription.D. tRNAs are required for translation.E. Each mRNA contains a single gene.
Suppose that rat liver expresses a protein called Yorfavase. The enzyme is composed of 192 amino acid residues, and thus the coding region of the yfg gene consists of 576 bp. However, the rat genome database indicates that the yfg gene consists of 1440 bp.Select which type of DNA does not contribute to the additional 864 bp found in the yfg gene.A. 5'-end untranslated regulatory region.B. centromeric DNAC. DNA coding for a signal sequenceD. noncoding intronE. promoter sequence
During translation, when would translation begin based on the following mRNA sequence?UGACGGCAAAUGACGCCUGAUUAAAAAAAAAAAAAAAAAA. Since there is a UGA at the beginning of the sequence, this mRNA sequence would not be translated because UGA is a stop codon.B. The UGA at the beginning would be ignored and translocation would begin at AUG, because the ribosome looks for this codon as the start codon.C. This is  a trick question because this sequence is obviously DNA because of the uracil bases that are present.
Using the following DNA strands, identify the primary structure of the encoded protein. Show each step you took.5' - T A T A A A A A C T A A T G T T G C A T T A A G A A T A A A - 3'3' - A T A T T T T T G A T T A C A A C G T A A T T C T T A T T T  - 5
A nontemplate strand of bacterial DNA has the following base sequence: 5' - ATGATACTAAGGCCC - 3'Determine the sequence of the amino acids that will be encoded. 
Transcribe and translate the following DNA sequence (nontemplate strand): 5' - ATGGCCGGTTATTAAGCA - 3'.
An RNA molecule has the following sequence: 5'-AUGAUUCGCGAACUUGCCAAUGACUAA-3'Give the sequence of:A. The DNA of the corresponding gene. Give your answer in the 5' to 3' direction.B. The resulting protein when this RNA is translated. Use the single letter code.
How many different possible 9 bp DNA sequences can code for Arg-Leu-Ser?a. 18b. 32c. 36d. 144e. 216
A eukaryotic mRNA has the following sequence: 5'-AUGCCCCGAACCUCAAAGUGA-3'. How many codons does it contain, and how many amino acids have been coded?
Translate the following sequence:AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAAA. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His IleB. Met Gly Tyr Val Ser Thr Arg Phe Ser Glu ProC. Met Gly Tyr Ile Gln Glu Pro ThrD. Met Gly Tyr Ile Gln Val Thr Arg Arg Ser Pro His
The 5' untranslated region of the mRNA containsA. the termination sequenceB. The Shine-Dalgarno sequenceC. The promoterD. The 16S rRNA
How do stop codons on mRNA function to end protein synthesis?A. Since the stop codon is composed of more than three nucleotide bases, a stop codon cannot enter the ribosome, which forces protein synthesis to end.B. The polypeptide chain breaks away from the ribosome when the amino acid. methionine, is added to the chain in response to a stop codon.C. Protein synthesis ends at a stop codon because the stop codon does not code for an amino acid, so new amino acid is added to the polypeptide chain.D. A series of three stop codons in a row adds the three amino acids that signal the terminal end of the growing polypeptide chain.
Which of the following statements regarding translation is true?A. During peptide bond formation, the amino acids attached to the tRNA in the P site are covalently joined to the E site amino acid.B. During codon recognition, the incoming tRNA anticodon base-pairs with the mRNA codon in the P site.C. After translocation, the tRNA which had been in the P site is now in the A site.D. mRNA is translated in the 5' to 3' direction, while the protein is synthesized in the N-terminal to C-terminal direction.E. Polyribosomes are ribosomes that are associated with more than one mRNA.
During which stage of eukaryotic translation do the following processes take place?1. Hydrolysis of the bond between the amino acid and the tRNA in the P site.2. The small ribosomal subunit and tRNA binds the 5' cap of mRNA.3. Aminoacyl tRNA anticodon base pair with complementary mRNA codon in the A siteA. 1-termination; 2-initiation; 3-elongationB. 1-initiation; 2-elongation; 3-terminationC. 1-elongation; 2-termination; 3-initiationD. 1-initiation; 2-termination; 3-elongationE. 1-termination; 2-elongation; 3-initiation
The tRNA for which amino acid is the first to enter the ribosome?A. arginineB. lysineC. methionineD. histidine
Based on the DNA strand below, and assuming the promoter for this gene is located to the left, which protein sequence below does this sequencecode for? (Assume that the first nucleotide is the start of the first codon)5' - ATGTTGAAAATGCCGTAGAGGC - 3'A. Met-Leu-Lys-Met-Pro-ArgB. Met-Leu-Lys-Met-ProC. Met-Leu-Lys-Met-Pro-stop-ArgD. Met-ProE. Pro-Met-Lys-Leu-Met
The initial tRNA, carrying the first amino acid, occupies the A site on the ribosome.A. TrueB. False
You have synthesized the following protein: fMet-Pro-Asp-Gly-Thr. You accomplished this in a cell-free system containing tRNA molecules with the anticodons listed below3' - CCG - 5'; 3' - UGU- 5'; 3' - GGC - 5';  3' - UAC - 5'; 3' - CUG - 5';  mRNAConstruct the double-stranded DNA molecle from which this protein was synthesized. Show all your reasoning.
What is the first stage of protein synthesis?A. tRNA charging, in which the tRNAs bind to amino acidsB. initiation, in which the components necessary for translation are assembled at the ribosome.C. elongation, in which amino acids are joined to the polypeptide chain.D. The assembly of transcription factors at the promoter.E. setting the reading frame, where the initiation codon is recognized by RNA polymerase
What is the significance of transcription and translation in overall physiology of Human or bacterial cells?
Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid  in this codon chart is designated by a single letter code. Use these letters to indicate the amino acid sequence below. The mRNA sequence is shown below:AUGUACACAGCAAUCUCCGGAAGGGAGGCGACG
Which of the following describes the process of translation?A. mRNA is read 5' to 3' while the new protein is synthesized from the N-terminus to the C-terminusB. mRNA is read 5' to 3' while the new protein is synthesized from the C-terminus to the N-terminus.C. mRNA is read 3' to 5' while the new protein is synthesized from the N-terminus to the C-terminus.D. mRNA is read 3' to 5' while the new protein is synthesized from the C-terminus to the N-terminus.E. Template strand DNA is read 3' to 5' while the new RNA is synthesized from 5' to 3'.F. Template strand DNA is read 5' to 3' while the new RNA is synthesized from 3' to 5'.
How long would the peptide be that is translated from this mRNA sequence: 5' - AUGGGCUACCGA-3'A. 0B. 2C. 3D. 4
The genome of the nematode worm Caenorhabditis elegans contains 1.0 x 108 bp of DNA and about 21,200 genes. If the average protein encoded by each gene contains 400 amino acids, approximately what fraction of the Caenorhabditis elegans genome codes for protein?A. 2%B. 2.5%C. 20%D. 25%E. 50%