Repair Mechanisms and Telomeres

Concept: Proofreading and Repair Mechanisms

7m

Concept: Telomeres and Telomerase

7m

Repair Mechanisms and Telomeres Additional Practice Problems

Which of the following enzymes in base pair excision repair is NOT required to repair depurinated nucleotides?

A. DNA polymerase

B. Ligase

C. Glycosylase

D. Endonuclease

Watch Solution

Telomerase lengthens the ends of chromosomes. Telomerase is a(n) _____ polymerase that is comprised of a _____ primer.

A. DNA; RNA

B. RNA; DNA

C. DNA; DNA

D. RNA; RNA

Watch Solution

Below is the sequence of DNA at the end of a just replicated chromosome. The origin of replication is represented by the *:

*... AAGGCTAAGCAATTGTTCCCTTCCCTTCCCTTCC - 5'

*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'


*... AAGGCTAAGCAATTGTTCCCTTC - 5'

*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'

a. Label the sequences that were the leading and lagging strands.

b. Which of the following could be a telomerase RNA:

A. 5' - AAGGGAAG - 3'

B. 5' - TTCCCTTC - 3'

C. 5'- UUGGGUUG - 3'

D. 5' - UUCCCUUC - 3'

Watch Solution

Which DNA repair mechanism do you expect to fix errors that escaped repair by proofreading?

A. the mismatch repair system

B. base-excision repair

C. nucleotide-excision repair

D. photoreversion

Watch Solution

What is the most significant role of homologous recombination in eukaryotes that is not found in prokaryotes?

A. exchange of genetic information between homologous chromosomes

B. generation of heteroduplex DNA

C. gene conversion

D. DNA repair

Watch Solution

Homologous recombination may result in gene conversion when used to fix double-stranded DNA breaks because:

A. sister chromatids are always identical.

B. the Holliday junction may migrate, resulting in loss of genetic material.

C. strand invasion may introduce new genes onto the damaged chromosome.

D. homologous chromosomes may carry different alleles of the same gene.

Watch Solution

Which activities, listed as numbers 1 to 4, does E. coli DNA polymerase I have?

1. 5' to 3' polymerase

2. 3' to 5' poolymerase

3. 5' to 3' exonuclease

4. 3' to 5' exonuclease


A. 1 and 2

B. 1, 2, and 4

C. 1, 2, and 3

D. 1, 3, and 4 

E. 1 and 4

Watch Solution

Consider the following DNA sequence:

5' - TAAGCTGCTG - 3'

3' - ATTCGACGAC - 5'

A. Deamination occurs at the C at position 7 (bottom strand). Show the double-stranded DNA daughter sequences following a round of DNA synthesis.

B. What would happen if the original sequence were irradiated with UV?

C. What repair pathway would be used to repair the mutation in (A)?

D. What repair pathway would be used to repair the UV products in (B)?

Watch Solution

What is the composition of a telomerase enzyme

Watch Solution

What are telomeres-where it is located?

Watch Solution

In the synthesis of DNA ends by telomerase, what is the template strand, the end added, and the type of polymerase?

A. Lagging template strand, 5' end, DNA polymerase

B. Lagging template strand, 3' end, DNA polymerase

C. Leading template strand, 5' end, DNA polymerase

D. Leading template strand, 3' end, reverse transcriptase

E. Lagging template strand, 3' end, reverse transcriptase

Watch Solution

Telomeres are sequences added to the ends of chromosome through the activity of telomerase, which contains reverse transcriptase (RT). Why is RT a DNA polymerase? What template does it use? What is the primer?

Watch Solution