Biology Biology Practice Problems Solutions Library

Translation Solutions Library

Access 64 Translation video and text solutions to help you complete your homework. Need to revisit the concept? Watch our Translation learn videos.

Browse Solutions

64 solutions

Translation

Q. During translation, when would translation begin based on the following mRNA sequence?UGACGGCAAAUGACGCCUGAUUAAAAAAAAAAAAAAAAAA. Since there is a UG...

Solved • Oct 5, 2018

Translation

Q. Suppose that rat liver expresses a protein called Yorfavase. The enzyme is composed of 192 amino acid residues, and thus the coding region of the y...

Solved • Sep 30, 2018

Translation

Q. Which of the following statements regarding translation is true?A. During peptide bond formation, the amino acids attached to the tRNA in the P sit...

Solved • Sep 23, 2018

Translation

Q. During which stage of eukaryotic translation do the following processes take place?1. Hydrolysis of the bond between the amino acid and the tRNA in...

Solved • Sep 23, 2018

Translation

Q. Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of ...

Solved • Sep 17, 2018

Translation

Q. Using the following DNA strands, identify the primary structure of the encoded protein. Show each step you took.5' - T A T A A A A A C T A A T G T ...

Solved • Sep 16, 2018

Translation

Q. The tRNA for which amino acid is the first to enter the ribosome?A. arginineB. lysineC. methionineD. histidine

Solved • Sep 11, 2018

Translation

Q. How do stop codons on mRNA function to end protein synthesis?A. Since the stop codon is composed of more than three nucleotide bases, a stop codon ...

Solved • Sep 3, 2018

Translation

Q. Which of the following is a TRUE statement about geneexpression in prokaryotes?A. Gene expression includes transcription, but not translation.B. Tr...

Solved • Sep 2, 2018

Translation

Q. One strand ofa section of DNA isolated from E. coli reads:5' - GCA TAT GGC CTC CTC CGA GGA CGT CAT CAA - 3'A. Suppose mRNA is transcribed from this...

Solved • Aug 30, 2018

Translation

Q. The genome of the nematode worm Caenorhabditis elegans contains 1.0 x 108 bp of DNA and about 21,200 genes. If the average protein encoded by each ...

Solved • Aug 28, 2018

Translation

Q. Which of the following is true of the trafficking of proteins from the cytosol to the endoplasmic reticulum?A. The proteins are first completely sy...

Solved • Aug 27, 2018

Translation

Q. The 5' untranslated region of the mRNA containsA. the termination sequenceB. The Shine-Dalgarno sequenceC. The promoterD. The 16S rRNA

Solved • Aug 27, 2018

Translation

Q. In translation, the ribosome scans the mRNA first until it reaches _____?A. The P site on the ribosomeB. a start codonC. the promoter regionD. a tR...

Solved • Aug 15, 2018

Translation

Q. What is the first stage of protein synthesis?A. tRNA charging, in which the tRNAs bind to amino acidsB. initiation, in which the components necessa...

Solved • Aug 13, 2018

Translation

Q. Below is an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of the table with the appro...

Solved • Aug 13, 2018

Translation

Q. You have synthesized the following protein: fMet-Pro-Asp-Gly-Thr. You accomplished this in a cell-free system containing tRNA molecules with the an...

Solved • Aug 7, 2018

Translation

Q. An RNA molecule has the following sequence: 5'-AUGAUUCGCGAACUUGCCAAUGACUAA-3'Give the sequence of:A. The DNA of the corresponding gene. Give your a...

Solved • Aug 6, 2018

Translation

Q. A eukaryotic mRNA has the following sequence: 5'-AUGCCCCGAACCUCAAAGUGA-3'. How many codons does it contain, and how many amino acids have been coded?

Solved • Aug 3, 2018

Translation

Q. A nontemplate strand of bacterial DNA has the following base sequence: 5' - ATGATACTAAGGCCC - 3'Determine the sequence of the amino acids that will...

Solved • Jul 30, 2018

Translation

Q. Translate the following sequence:AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAAA. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His Il...

Solved • Jul 30, 2018

Translation

Q. The initial tRNA, carrying the first amino acid, occupies the A site on the ribosome.A. TrueB. False

Solved • Jul 27, 2018

Translation

Q. Transcribe and translate the following DNA sequence (nontemplate strand): 5' - ATGGCCGGTTATTAAGCA - 3'.

Solved • Jul 27, 2018

Translation

Q. Based on the DNA strand below, and assuming the promoter for this gene is located to the left, which protein sequence below does this sequencecode ...

Solved • Jul 25, 2018

Translation

Q. Which of the following statements concerning ribosomes are true?A. Several ribosomes are often attached to and translating the same mRNA.B. Ribosom...

Solved • Jul 25, 2018

Translation

Q.  Is protein synthesis the same in Prokaryotes and Eukaryotes?

Solved • Jul 24, 2018

Translation

Q. What is a promoter and what are the important sequences within a promoter?

Solved • Jul 20, 2018

Translation

Q. What are the differences between transcription and replication?

Solved • Jul 20, 2018

Translation

Q. What is translation?

Solved • Jul 20, 2018

Translation

Q. What is the significance of transcription and translation in overall physiology of Human or bacterial cells?

Solved • Jul 20, 2018

Translation

Q. How long would the peptide be that is translated from this mRNA sequence: 5' - AUGGGCUACCGA-3'A. 0B. 2C. 3D. 4

Solved • Jul 20, 2018

Translation

Q. What are the roles for Release factors and Elongation factors during translation?

Solved • Jul 20, 2018

Translation

Q. What is the function of a smaller subunit and large subunit of ribosomes?

Solved • Jul 20, 2018

Translation

Q. What are the functions of ribosomes, mRNA, rRNA and tRNA during translation?

Solved • Jul 20, 2018

Translation

Q. Which of the following describes the process of translation?A. mRNA is read 5' to 3' while the new protein is synthesized from the N-terminus to th...

Solved • Jul 19, 2018

Translation

Q. The genetic code has many important characteristics. For example, a specific codon always means the same thing in a particular species. Codons mean...

Solved • Jul 12, 2018

Translation

Q. Which molecule acts as an enzyme during the formation of peptide bonds between amino acids?A. Large ribosomal subunitB. Transfer RNAC. Messenger RN...

Solved • Jul 11, 2018

Translation

Q. Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid  in this codon chart is designa...

Solved • Jul 10, 2018

Translation

Q. How many different possible 9 bp DNA sequences can code for Arg-Leu-Ser?a. 18b. 32c. 36d. 144e. 216

Solved • Jul 5, 2018

Translation

Q. RNAse is a protein that is present in our cells and it has 104 residues (amino acids). The cDNA for this protein has approximately ____ nucleotides...

Solved • Jul 3, 2018

Translation

Q. Draw a simple diagram showing where transcription, RNA modification/splicing, and translation occur in the cell.

Solved • Jun 28, 2018

Translation

Q. When does translation stop? What molecule comes into the A site to stop translation?

Solved • Jun 14, 2018

Translation

Q. A tRNA anticodon is 5' GAA 3'. Answer the following questions.Which one of the following codons is recognized by this tRNA?a. 5' UUC 3'b. 5' CTT 3'...

Solved • Jun 12, 2018

Translation

Q. Write the base sequence and indicate the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences.5'AAAAGG...

Solved • Jun 11, 2018

Translation

Q.

Solved • Jun 6, 2018

Translation

Q. When is a peptide bond formed during the process of translation?a. During the elongation phase just after a tRNA charged with an amino acid binds t...

Solved • May 31, 2018

Translation

Q. Transcription and Translation Worksheet 1. The DNA sequence 5’-T T A A C G G C T T T T T T C G T A C A T-3’ was used as a template to synthesize a ...

Solved • May 31, 2018

Translation

Q. At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their struc...

Solved • May 30, 2018

Translation

Q. Protein Synthesis Worksheet:

Solved • May 30, 2018

Translation

Q. A. Replication          B. Transcription          C. Post-transcriptional processing         D. Translation          E. Post-translational processi...

Solved • Nov 15, 2017

Translation

Q. The type of RNA that delivers amino acids to the ribosome during protein synthesis is tRNA. a. True b. False

Solved • Jul 31, 2017

Translation

Q. There are only two main types of RNA needed to make proteins. They are tRNA and rRNA.  a. True b. False

Solved • Jul 31, 2017

Translation

Q. The process by which cells use the information of RNA molecules to make proteins is transcription.  a. True b. False

Solved • Jul 31, 2017

Translation

Q. What would be the first codon translated in the mRNA sequence 5' – GGAAUGAAACAGGAACCC – 3'?  a. GGA b. CCC c. AUG d. GAA e. AAU

Solved • Jul 31, 2017

Translation

Q. Which of the following does not occur during translation's termination step?  a. The initiator tRNA brings the amino acid methionine b. Ribosomal...

Solved • Jul 31, 2017

Translation

Q. The step of translation in which release factors bind to a stop codon is:  a. Mitosis b. Termination c. Initiation d. Elongation e. Transcript...

Solved • Jul 31, 2017

Translation

Q. The step of translation in which amino acids are added one at a time to the growing polypeptide is:  a. Mitosis b. Initiation c. Elongation d. ...

Solved • Jul 31, 2017

Translation

Q. The step of translation in which an mRNA, a small ribosomal subunit, and the initiator tRNA are aligned together is:  a. Initiation b. Mitosis c...

Solved • Jul 31, 2017

Translation

Q. A three base sequence (loop) in tRNA that is complementary to a sequence of three bases in mRNA is:  a. A codon b. An anticodon c. A promoter d...

Solved • Jul 31, 2017

Translation

Q. The process used by cells to convert the mRNA "message" into a sequence of amino acids is:  a. Transcription b. Replication c. Mitosis d. Amino...

Solved • Jul 31, 2017

Translation

Q. The type of RNA that carries each amino acid to the ribosome is:  a. Complementary RNA b. Messenger RNA c. Ribosomal RNA d. Double-stranded RNA...

Solved • Jul 31, 2017

Translation

Q. The type of RNA that carries the information that specifies a protein is:  a. Transfer RNA b. Ribosomal RNA c. Messenger RNA d. Double-stranded...

Solved • Jul 31, 2017

Translation

Q. A particular triplet of bases in the DNA is ATC. The corresponding triplet on the anti-codon is: a. ATC  b. UTC c. TAG d. UTG e. AUC

Solved • Jul 26, 2017

Translation

Q. All of the following are directly involved in translation EXCEPT: a. mRNA b. tRNA c. ribosomes d. DNA

Solved • Jul 26, 2017