Biology Biology Practice Problems Solutions Library

Nucleic Acids Solutions Library

Access 47 Nucleic Acids video and text solutions to help you complete your homework. Need to revisit the concept? Watch our Nucleic Acids learn videos.

Browse Solutions

47 solutions

Nucleic Acids

Q. According to Chargaff's rules, if a genome is 30% adenine, then what percentage of the genome should be thymine?A. 30%B. 35%C. 40%D. 20%E. 70%

Solved • Oct 20, 2018

Nucleic Acids

Q. The template strand of a given gene includes the sequence 3' - T G A T G T C C G A T T - 5'. What is the sequence of the non-template strand?A. 3' ...

Solved • Sep 23, 2018

Nucleic Acids

Q. Which of the following does not provide evidence to support the conclusion that nitrogenous bases pair in specific combinations?A. a purine-purine ...

Solved • Sep 21, 2018

Nucleic Acids

Q. Adenine makes up 22% of the nucleotides in a particular sample ofgenomic DNA. What percentage of the nucleotides in this sample are guanine?A. 18B....

Solved • Sep 21, 2018

Nucleic Acids

Q. Reduction of -OH at the C2 in D-ribose leads to the creation of _____ found in the sugar backbone of DNA.A. celluloseB. β-D-2-oxyriboseC. β-D-2-deo...

Solved • Sep 17, 2018

Nucleic Acids

Q. A. Name the nucleotide.B. Draw the new chemical structure if a hydrolysis reaction were to occur with the nucleotide.

Solved • Sep 16, 2018

Nucleic Acids

Q. A. Name the sugarB. Label each carbonC. Determine the number of -OH groups in the sugar

Solved • Sep 16, 2018

Nucleic Acids

Q. Chargaff's results yielded a molar ratio of 1.67 for A to G in yeast DNA, 1.92 for T to C, 1.03 for A to T, and 1.20 for G to C. The ratio of purin...

Solved • Sep 2, 2018

Nucleic Acids

Q. Deduce whether each of the nucleic acid molecules in the table below is DNA or RNA, and single-stranded or double-stranded. Explain your reasoning.

Solved • Aug 21, 2018

Nucleic Acids

Q. The base compositions of samples of genomic DNA from several different animals were given below. Which samples are likely to come from the same spe...

Solved • Aug 18, 2018

Nucleic Acids

Q. Complete each of the following senteces by selecting the correct answer:A. Cytosine is a (purine base / pyrimidine base / purine nucleoside / pyrim...

Solved • Aug 16, 2018

Nucleic Acids

Q. Which of the following statements is TRUE?A. Histones are rich in the amino acids D and E, and interact with DNA via ionic bonds.B. RNA is transcri...

Solved • Aug 15, 2018

Nucleic Acids

Q. The presence of a 2'-OH group indicates that the pentose sugar in a nucleotide is ______ while the absence of a 2'-OH group indicates the sugar in ...

Solved • Aug 10, 2018

Nucleic Acids

Q. You sequenced three DNA strands that are fragments of a single gene. Manually assemble the fragments and write down the complete (full) sequence.Fr...

Solved • Aug 8, 2018

Nucleic Acids

Q. What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.5' - TAAACAAAGAAGTACAACAA - 3'

Solved • Aug 6, 2018

Nucleic Acids

Q. What is the complementary DNA strand of the sequence 5' - AGTCTGAC - 3'?

Solved • Jul 30, 2018

Nucleic Acids

Q. If one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand?A. GACGTCAB. AGTACTGC. GTCATGAD. TCATGAC

Solved • Jul 23, 2018

Nucleic Acids

Q. Which of the following molecules is ribose?

Solved • Jul 18, 2018

Nucleic Acids

Q. Which of the following molecules is phosphate?

Solved • Jul 18, 2018

Nucleic Acids

Q. Which of the following is a nitrogenous base known as a purine?

Solved • Jul 18, 2018

Nucleic Acids

Q. Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat, which breaks h...

Solved • Jul 12, 2018

Nucleic Acids

Q. Identify the key structural features of a DNA molecule. Mark all that apply: A. DNA strands are antiparallel and include a 5' end and a 3' end.B. S...

Solved • Jul 9, 2018

Nucleic Acids

Q. Which of the following DNA molecules is the most stable?a. 5'-CTGCATAC-3'    3'-GACGTATG-5'b. 5'-GAAATTTC-3'    3'-CTTTAAAG-5'c. 5'-AGTCGAAT-3'    ...

Solved • Jun 13, 2018

Nucleic Acids


Solved • Jun 7, 2018

Nucleic Acids

Q. What is the complementary DNA sequence to 5′ ATGCATCG 3′? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.If 5′ CGATGCAT ...

Solved • Jun 7, 2018

Nucleic Acids

Q. Which of the following statements about DNA and RNA is FALSE?a. DNA forms a double-stranded helical structure that contains base pairs whereas RNA ...

Solved • Jun 6, 2018

Nucleic Acids

Q. How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'- CATAGGA- 3'

Solved • Jun 6, 2018

Nucleic Acids

Q. What bonds form between complementary base pairs? Between a base and the deoxyribose sugar?

Solved • May 17, 2018

Nucleic Acids

Q. How many phosphoester (phosphate ester) and phosphoanhydride bonds are in adenosine monophosphate (AMP) and adenosine triphosphate (ATP)?

Solved • Dec 21, 2017

Nucleic Acids

Q. How are the monomers in nucleic acids joined?  a. Peptide bonds between carbohydrates b. Peptide bonds between amino acids c. Phosphodiester bon...

Solved • Aug 1, 2017

Nucleic Acids

Q. RNA differs from DNA in that:  a. RNA contains ribose b. RNA contains uracil c. All are correct d. RNA is usually single stranded e. RNA can c...

Solved • Jul 31, 2017

Nucleic Acids

Q. The rungs of the DNA ladder:   a. Are formed by base pairs joined by covalent bonds b. Are formed by base pairs joined by hydrogen bonds c. Are ...

Solved • Jul 31, 2017

Nucleic Acids

Q. The twisted ladder of DNA is composed of building blocks called:  a. Amino acids b. Monosaccharides c. Phospholipids d. Disaccharides e. Nucle...

Solved • Jul 31, 2017

Nucleic Acids

Q. The 3' and 5' designations refer to the numbers that chemists assign to the:  a. Hydrogen atoms of deoxyribose b. Oxygen atoms of deoxyribose c....

Solved • Jul 31, 2017

Nucleic Acids

Q. Purine bases have a _________ ___________ structure: a. Single, ringb. Single, trianglec. Double, triangled. Double, ringe. Triple, ring

Solved • Jul 31, 2017

Nucleic Acids

Q. Pyrimidine bases have a __________ __________ structure:  a. Single, ring b. Single, triangle c. Double, ring d. Double, triangle e. Triple, r...

Solved • Jul 31, 2017

Nucleic Acids

Q. The DNA nitrogen bases that are purines are:  a. Adenine and thymine b. Adenine and uracil c. Guanine and thymine d. Guanine and cytosine e. A...

Solved • Jul 31, 2017

Nucleic Acids

Q. The DNA nitrogen bases that are pyrimidines are:  a. Cytosine and guanine b. Uracil and cytosine c. Thymine and cytosine d. Thymine and adenine...

Solved • Jul 31, 2017

Nucleic Acids

Q. Strands of DNA are joined by:  a. Hydrogen bonds b. Covalent bonds c. Ionic bonds d. Phosphodiester bond

Solved • Jul 31, 2017

Nucleic Acids

Q. DNA's sugar-phosphate backbones are joined with:  a. Ionic bonds b. Hydrogen bonds c. Weak chemical bonds d. Covalent bonds

Solved • Jul 31, 2017

Nucleic Acids

Q. If you have 56 total nucleotides and 13 are C, how many are G? a. 13 b. 15 c. 26 d. 30 e. none of these answers is correct.

Solved • Jul 26, 2017

Nucleic Acids

Q. If cytosine makes up 22% of the nucleotides in a DNA sample, then adenine would make up what percent of the bases? a. 33 b. 44 c. 28 d. 56 e. ...

Solved • Jul 26, 2017

Nucleic Acids

Q. Which of the following is not found in RNA? a. adenine b cytosine c. guanine d. thymine e. uracil

Solved • Jul 19, 2017

Nucleic Acids

Q. Which of the following is not a component of nucleic acids? a. a five-carbon sugar b. a six-carbon sugar c. a phosphate group d. phosphodiester...

Solved • Jul 19, 2017

Nucleic Acids

Q. If a double-stranded DNA sample were composed of 10% thymine, what would be the percentage of guanine? a. 10% b. 20% c. 40% d. 80%

Solved • Jul 17, 2017

Nucleic Acids

Q. A single strand of DNA contains the following sequence: 5'-GATTCGTCAACTG-3', the complementary single strand is: a. 3'-CUAAGCAGUUGAC-5' b. 3'-CTA...

Solved • Jul 13, 2017

Nucleic Acids

Q. Which of the following statements about DNA is  false? a. DNA contains deoxyribose as its sugar b. DNA contains the base thymine c. DNA is doubl...

Solved • Jul 13, 2017