Biology Biology Practice Problems Solutions Library

Genetic Code Solutions Library

Access 14 Genetic Code video and text solutions to help you complete your homework. Need to revisit the concept? Watch our Genetic Code learn videos.

Browse Solutions

14 solutions

Genetic Code

Q. Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Cys.

Solved • Jan 26, 2021

Genetic Code

Q. Determine possible amino acid sequences for the mRNA sequence shown below.5'-AGAUCGGCGAAAGUCA-3'Select all possible amino acid sequences. There wil...

Solved • May 26, 2020

Genetic Code

Q. Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of ...

Solved • Sep 17, 2018

Genetic Code

Q. A eukaryotic mRNA has the following sequence: 5'-AUGCCCCGAACCUCAAAGUGA-3'. How many codons does it contain, and how many amino acids have been coded?

Solved • Aug 3, 2018

Genetic Code

Q. A nontemplate strand of bacterial DNA has the following base sequence: 5' - ATGATACTAAGGCCC - 3'Determine the sequence of the amino acids that will...

Solved • Jul 30, 2018

Genetic Code

Q. Translate the following sequence:AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAAA. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His Il...

Solved • Jul 30, 2018

Genetic Code

Q. How long would the peptide be that is translated from this mRNA sequence: 5' - AUGGGCUACCGA-3'A. 0B. 2C. 3D. 4

Solved • Jul 20, 2018

Genetic Code

Q. The genetic code has many important characteristics. For example, a specific codon always means the same thing in a particular species. Codons mean...

Solved • Jul 12, 2018

Genetic Code

Q. Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid  in this codon chart is designa...

Solved • Jul 10, 2018

Genetic Code

Q. How many different possible 9 bp DNA sequences can code for Arg-Leu-Ser?a. 18b. 32c. 36d. 144e. 216

Solved • Jul 5, 2018

Genetic Code

Q. A tRNA anticodon is 5' GAA 3'. Answer the following questions.Which one of the following codons is recognized by this tRNA?a. 5' UUC 3'b. 5' CTT 3'...

Solved • Jun 12, 2018

Genetic Code

Q. Write the base sequence and indicate the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences.5'AAAAGG...

Solved • Jun 11, 2018

Genetic Code

Q. A particular triplet of bases in the DNA is ATC. The corresponding triplet on the anti-codon is: a. ATC  b. UTC c. TAG d. UTG e. AUC

Solved • Jul 26, 2017

Genetic Code

Q. A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet in the complementary strand of mRNA? a. AGT ...

Solved • Jul 26, 2017