Mutation Video Lessons

Video Thumbnail

Concept

Problem: The sequence below is for a wild type gene whose mutation leads to a condition of defective iron transport called hemochromatosis. In hemochromatosis, the highlighted cysteine (Cys, C) residue is mutated to a tyrosine (Tyr, Y) residue. The coding strand of DNA is shown in the sequence as well as the protein sequence in single letter symbols. Which of the following is the most likely mutation at the DNA level?DNA : gataaccttggctgtaccccccggggaagagcagagatatacgtgccaggtggagcaccc+2fr:      - I - - T - - L - - A - - V - - P - - P - - G - - E - - E - - Q - - R - - Y - - T - - C - - Q - - V - - E - - H - - P -A. UGU to UCUB. UGC to UUAC. UGC to UACD. TGC to TACE. TAC to TGC

FREE Expert Solution

In the given problem, the first amino acid that is encoded from the given sequence is isoleucine (I), which can be from 3 possible codons: AUU, AUC, or AUA. This would tell us that the given DNA sequence is arranged to give codons according to the reading frame given below:

g ata acc ttg gct gta ccc ccc ggg gaa gag cag aga tat acg tgc cag gtg gag cac cc

View Complete Written Solution
Problem Details

The sequence below is for a wild type gene whose mutation leads to a condition of defective iron transport called hemochromatosis. In hemochromatosis, the highlighted cysteine (Cys, C) residue is mutated to a tyrosine (Tyr, Y) residue. The coding strand of DNA is shown in the sequence as well as the protein sequence in single letter symbols. Which of the following is the most likely mutation at the DNA level?

DNA : gataaccttggctgtaccccccggggaagagcagagatatacgtgccaggtggagcaccc

+2fr:      - I - - T - - L - - A - - V - - P - - P - - G - - E - - E - - Q - - R - - Y - - T - - C - - Q - - V - - E - - H - - P -

A. UGU to UCU

B. UGC to UUA

C. UGC to UAC

D. TGC to TAC

E. TAC to TGC

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Mutation concept. You can view video lessons to learn Mutation. Or if you need more Mutation practice, you can also practice Mutation practice problems.