Biology Practice Problems Mutation Practice Problems Solution: The sequence below is for a wild type gene whose m...

Solution: The sequence below is for a wild type gene whose mutation leads to a condition of defective iron transport called hemochromatosis. In hemochromatosis, the highlighted cysteine (Cys, C) residue is mutated to a tyrosine (Tyr, Y) residue. The coding strand of DNA is shown in the sequence as well as the protein sequence in single letter symbols. Which of the following is the most likely mutation at the DNA level?DNA : gataaccttggctgtaccccccggggaagagcagagatatacgtgccaggtggagcaccc+2fr:      - I - - T - - L - - A - - V - - P - - P - - G - - E - - E - - Q - - R - - Y - - T - - C - - Q - - V - - E - - H - - P -A. UGU to UCUB. UGC to UUAC. UGC to UACD. TGC to TACE. TAC to TGC

Problem

The sequence below is for a wild type gene whose mutation leads to a condition of defective iron transport called hemochromatosis. In hemochromatosis, the highlighted cysteine (Cys, C) residue is mutated to a tyrosine (Tyr, Y) residue. The coding strand of DNA is shown in the sequence as well as the protein sequence in single letter symbols. Which of the following is the most likely mutation at the DNA level?

DNA : gataaccttggctgtaccccccggggaagagcagagatatacgtgccaggtggagcaccc

+2fr:      - I - - T - - L - - A - - V - - P - - P - - G - - E - - E - - Q - - R - - Y - - T - - C - - Q - - V - - E - - H - - P -

A. UGU to UCU

B. UGC to UUA

C. UGC to UAC

D. TGC to TAC

E. TAC to TGC

Solution

In the given problem, the first amino acid that is encoded from the given sequence is isoleucine (I), which can be from 3 possible codons: AUU, AUC, or AUA. This would tell us that the given DNA sequence is arranged to give codons according to the reading frame given below:

g ata acc ttg gct gta ccc ccc ggg gaa gag cag aga tat acg tgc cag gtg gag cac cc

Solution BlurView Complete Written Solution