Repair Mechanisms and Telomeres Video Lessons

Video Thumbnail


Problem: Below is the sequence of DNA at the end of a just replicated chromosome. The origin of replication is represented by the *:*... AAGGCTAAGCAATTGTTCCCTTCCCTTCCCTTCC - 5'*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'*... AAGGCTAAGCAATTGTTCCCTTC - 5'*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'a. Label the sequences that were the leading and lagging strands.b. Which of the following could be a telomerase RNA:A. 5' - AAGGGAAG - 3'B. 5' - TTCCCTTC - 3'C. 5'- UUGGGUUG - 3'D. 5' - UUCCCUUC - 3'

FREE Expert Solution

During the process of replication, the polymerase enzyme starts the base synthesis as connected with the primers. these primers are then subsequently removed after replication. Remember that the lagging strand makes use of multiple primers as the polymerase enzyme can only synthesize polynucleotides in the 5' to 3' direction. On the other hand, the leading strand only requires a single primer and it is expected to synthesize complementary strands up to the very last base.

View Complete Written Solution
Problem Details

Below is the sequence of DNA at the end of a just replicated chromosome. The origin of replication is represented by the *:





a. Label the sequences that were the leading and lagging strands.

b. Which of the following could be a telomerase RNA:

A. 5' - AAGGGAAG - 3'

B. 5' - TTCCCTTC - 3'

C. 5'- UUGGGUUG - 3'

D. 5' - UUCCCUUC - 3'

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Repair Mechanisms and Telomeres concept. You can view video lessons to learn Repair Mechanisms and Telomeres. Or if you need more Repair Mechanisms and Telomeres practice, you can also practice Repair Mechanisms and Telomeres practice problems.