Solution: Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of this mRNA molecule into protein.5' - UAUGAUACUGCUAUCUAGGACU - 3'A. 5' - UAG - 3'B. 5' - GAU - 3'C. 5' - CAG - 3'D. 5' - GAC - 3'

Problem

Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of this mRNA molecule into protein.

5' - UAUGAUACUGCUAUCUAGGACU - 3'

A. 5' - UAG - 3'

B. 5' - GAU - 3'

C. 5' - CAG - 3'

D. 5' - GAC - 3'

Solution

During translation, the codons are paired with anticodons through complementarity. The anticodons are in the tRNAs, which are also charged with the corresponding amino acid for the codon that they are complementary to. 

Solution BlurView Complete Written Solution