Translation Video Lessons

Video Thumbnail

Concept

Problem: Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of this mRNA molecule into protein.5' - UAUGAUACUGCUAUCUAGGACU - 3'A. 5' - UAG - 3'B. 5' - GAU - 3'C. 5' - CAG - 3'D. 5' - GAC - 3'

FREE Expert Solution

During translation, the codons are paired with anticodons through complementarity. The anticodons are in the tRNAs, which are also charged with the corresponding amino acid for the codon that they are complementary to. 

View Complete Written Solution
Problem Details

Propose a sequence for the anticodon present in the tRNA charged with leucine that would bind to both CUG and CUA and allow for the translation of this mRNA molecule into protein.

5' - UAUGAUACUGCUAUCUAGGACU - 3'

A. 5' - UAG - 3'

B. 5' - GAU - 3'

C. 5' - CAG - 3'

D. 5' - GAC - 3'

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Translation concept. You can view video lessons to learn Translation. Or if you need more Translation practice, you can also practice Translation practice problems.