Transcription Video Lessons

Video Thumbnail

Concept

Problem: What would be the sequence of the RNA produced from teh following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the5' end at the left and assume transcription continues to the end of the sequence shown.5' - CCCGGTGAATGCTGAATCATATCTTA - 3'3' - GGGCCACTTACGACTTAGTATAGAAT - 5'                                                 ←

FREE Expert Solution

Transcription is the process of creating an RNA equivalent of specific DNA sequences, particularly, the genes. In this process, the DNA will serve as the template for RNA polymerase, which will synthesize the complementary RNA sequence. 

View Complete Written Solution
Problem Details

What would be the sequence of the RNA produced from teh following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the5' end at the left and assume transcription continues to the end of the sequence shown.

5' - CCCGGTGAATGCTGAATCATATCTTA - 3'

3' - GGGCCACTTACGACTTAGTATAGAAT - 5'

                                                 ←

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Transcription concept. You can view video lessons to learn Transcription. Or if you need more Transcription practice, you can also practice Transcription practice problems.