Problem: What would be the sequence of the RNA produced from the following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the 5' end at the left and assume transcription continues to the end of the sequence shown.                         →5' - CCCGGTGAATGCTGAATCATATCTTA - 3'3' - GGGCCACTTACGACTTAGTATAGAAT - 5'

🤓 Based on our data, we think this question is relevant for Professor Facciotti's class at UCD.

FREE Expert Solution

Transcription is the process of creating an RNA equivalent of specific DNA sequences, particularly, the genes. In this process, the DNA will serve as the template for RNA polymerase, which will synthesize the complementary RNA sequence. 

View Complete Written Solution
Problem Details

What would be the sequence of the RNA produced from the following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the 5' end at the left and assume transcription continues to the end of the sequence shown.

                         →

5' - CCCGGTGAATGCTGAATCATATCTTA - 3'

3' - GGGCCACTTACGACTTAGTATAGAAT - 5'