Transcription Video Lessons

Video Thumbnail

Concept

Problem: The extreme 3' end of a prokaryotic mRNA is given below. What features of this RNA indicate that the sequence includes a transcription termination site? Check all features that apply.5' ... GAUGGGCGGGGGGGAAAUUAACCCCCCCGCCCUUUUUUU 3'A. It contains a stop codonB. It is a complete ORFC. It has an array of U nucleotides near its 3' endD. It has the potential to form a stem-loop structure

FREE Expert Solution

In prokaryotes, there are two known types of transcription terminators: the ρ-dependent termination and the ρ-independent termination. Rho (ρ) is a protein factor present in prokaryotes. In a ρ-dependent termination, it migrates toward the 3' end until it reaches the transcription complex paused at a termination site.

View Complete Written Solution
Problem Details

The extreme 3' end of a prokaryotic mRNA is given below. What features of this RNA indicate that the sequence includes a transcription termination site? Check all features that apply.

5' ... GAUGGGCGGGGGGGAAAUUAACCCCCCCGCCCUUUUUUU 3'

A. It contains a stop codon

B. It is a complete ORF

C. It has an array of U nucleotides near its 3' end

D. It has the potential to form a stem-loop structure

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Transcription concept. You can view video lessons to learn Transcription. Or if you need more Transcription practice, you can also practice Transcription practice problems.

What professor is this problem relevant for?

Based on our data, we think this problem is relevant for Professor Niles' class at USFCA.