Translation Video Lessons

Video Thumbnail

Concept

Problem: Translate the following sequence:AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAAA. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His IleB. Met Gly Tyr Val Ser Thr Arg Phe Ser Glu ProC. Met Gly Tyr Ile Gln Glu Pro ThrD. Met Gly Tyr Ile Gln Val Thr Arg Arg Ser Pro His

FREE Expert Solution

The translation of mRNA transcript to a polypeptide sequence follows a specific set of simple guidelines. Most of these revolve on three-base RNA sequences known as codons. The first is the determination of the start codon and the reading frame. The codon that signals the start of translation within a sequence is AUG. This also determines the reading frame, or how the sequence is divided into codons for translation. For example, since the mRNA transcript starts with AUG, if grouped into codons, the sequence would look like this:

View Complete Written Solution
Problem Details

Translate the following sequence:

AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAA

A. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His Ile

B. Met Gly Tyr Val Ser Thr Arg Phe Ser Glu Pro

C. Met Gly Tyr Ile Gln Glu Pro Thr

D. Met Gly Tyr Ile Gln Val Thr Arg Arg Ser Pro His

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Translation concept. You can view video lessons to learn Translation. Or if you need more Translation practice, you can also practice Translation practice problems.