Ch.17 - Gene ExpressionWorksheetSee all chapters
All Chapters
Ch.1 - Introduction to Biology
Ch.2 - Chemistry
Ch.3 - Water
Ch.4 - Carbon
Ch.5 - Biological Molecules
Ch.6 - Cells
Ch.7 - The Membrane
Ch.8 - Energy and Metabolism
Ch.9 - Respiration
Ch.10 - Photosynthesis
Ch.11 - Cell Signaling
Ch.12 - Cell Division
Ch.13 - Meiosis
Ch.14 - Mendelian Genetics
Ch.15 - Chromosomal Theory of Inheritance
Ch.16 - DNA Synthesis
Ch.17 - Gene Expression
Ch.18 - Regulation of Expression
Ch.19 - Viruses
Ch.20 - Biotechnology
Ch.21 - Genomics
Ch.22 - Development
Ch.23 - Evolution by Natural Selection
Ch.24 - Evolution of Populations
Ch.25 - Speciation
Ch.26 - History of Life on Earth
Ch.27 - Phylogeny
Ch.28 - Prokaryotes
Ch.29 - Protists
Ch.30 - Plants
Ch.31 - Fungi
Ch.32 - Overview of Animals
Ch.33 - Invertebrates
Ch.34 - Vertebrates
Ch.35 - Plant Anatomy
Ch.36 - Vascular Plant Transport
Ch.37 - Soil
Ch.38 - Plant Reproduction
Ch.39 - Plant Sensation and Response
Ch.40 - Animal Form and Function
Ch.41 - Digestive System
Ch.42 - Circulatory System
Ch.43 - Immune System
Ch.44 - Osmoregulation and Excretion
Ch.45 - Endocrine System
Ch.46 - Animal Reproduction
Ch.47 - Nervous System
Ch.48 - Sensory Systems
Ch.49 - Muscle Systems
Ch.50 - Ecology
Ch.51 - Animal Behavior
Ch.52 - Population Ecology
Ch.53 - Community Ecology
Ch.54 - Ecosystems
Ch.55 - Conservation Biology
Sections
Gene Expression and the Genetic Code
Transcription
RNA Processing
Translation
Mutation

Solution: Translate the following sequence:AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAAA. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His IleB. Met Gly Tyr Val Ser Thr Arg Phe Ser Glu ProC. Met Gly Tyr Ile Gln Glu Pro ThrD. Met Gly Tyr Ile Gln Val Thr Arg Arg Ser Pro His

Problem

Translate the following sequence:

AUGGGAUAUGUCUCUACCAGAUCCAGGUUACACGGAGGAGCCCACAUAA

A. Mat Gly Tyr Val Ser Thr Arg Phe Ser Leu His Gly Gly Ala His Ile

B. Met Gly Tyr Val Ser Thr Arg Phe Ser Glu Pro

C. Met Gly Tyr Ile Gln Glu Pro Thr

D. Met Gly Tyr Ile Gln Val Thr Arg Arg Ser Pro His

Solution

The translation of mRNA transcript to a polypeptide sequence follows a specific set of simple guidelines. Most of these revolve on three-base RNA sequences known as codons. The first is the determination of the start codon and the reading frame. The codon that signals the start of translation within a sequence is AUG. This also determines the reading frame, or how the sequence is divided into codons for translation. For example, since the mRNA transcript starts with AUG, if grouped into codons, the sequence would look like this:

Solution BlurView Complete Written Solution