Solution: Based on the DNA strand below, and assuming the promoter for this gene is located to the left, which protein sequence below does this sequencecode for? (Assume that the first nucleotide is the start of the first codon)5' - ATGTTGAAAATGCCGTAGAGGC - 3'A. Met-Leu-Lys-Met-Pro-ArgB. Met-Leu-Lys-Met-ProC. Met-Leu-Lys-Met-Pro-stop-ArgD. Met-ProE. Pro-Met-Lys-Leu-Met

The translation process makes use of codons that serve as reference for the corresponding amino acid sequence. As stated, the sequence shows the first nucleotide as the start of the first codon. Thus, this will only need a direct conversion to an mRNA transcript (i.e. the strand shown is not the remplate strand). Aside from the corresponding amino acids, the codons also code for two distinct signals: the start and the termination of the translation process. The start codon is AUG while the stop codons are UAG, UGA and UAA.