Ch.17 - Gene ExpressionWorksheetSee all chapters
All Chapters
Ch.1 - Introduction to Biology
Ch.2 - Chemistry
Ch.3 - Water
Ch.4 - Carbon
Ch.5 - Biological Molecules
Ch.6 - Cells
Ch.7 - The Membrane
Ch.8 - Energy and Metabolism
Ch.9 - Respiration
Ch.10 - Photosynthesis
Ch.11 - Cell Signaling
Ch.12 - Cell Division
Ch.13 - Meiosis
Ch.14 - Mendelian Genetics
Ch.15 - Chromosomal Theory of Inheritance
Ch.16 - DNA Synthesis
Ch.17 - Gene Expression
Ch.18 - Regulation of Expression
Ch.19 - Viruses
Ch.20 - Biotechnology
Ch.21 - Genomics
Ch.22 - Development
Ch.23 - Evolution by Natural Selection
Ch.24 - Evolution of Populations
Ch.25 - Speciation
Ch.26 - History of Life on Earth
Ch.27 - Phylogeny
Ch.28 - Prokaryotes
Ch.29 - Protists
Ch.30 - Plants
Ch.31 - Fungi
Ch.32 - Overview of Animals
Ch.33 - Invertebrates
Ch.34 - Vertebrates
Ch.35 - Plant Anatomy
Ch.36 - Vascular Plant Transport
Ch.37 - Soil
Ch.38 - Plant Reproduction
Ch.39 - Plant Sensation and Response
Ch.40 - Animal Form and Function
Ch.41 - Digestive System
Ch.42 - Circulatory System
Ch.43 - Immune System
Ch.44 - Osmoregulation and Excretion
Ch.45 - Endocrine System
Ch.46 - Animal Reproduction
Ch.47 - Nervous System
Ch.48 - Sensory Systems
Ch.49 - Muscle Systems
Ch.50 - Ecology
Ch.51 - Animal Behavior
Ch.52 - Population Ecology
Ch.53 - Community Ecology
Ch.54 - Ecosystems
Ch.55 - Conservation Biology
Gene Expression and the Genetic Code
RNA Processing

Solution: Based on the DNA strand below, and assuming the promoter for this gene is located to the left, which protein sequence below does this sequencecode for? (Assume that the first nucleotide is the start of the first codon)5' - ATGTTGAAAATGCCGTAGAGGC - 3'A. Met-Leu-Lys-Met-Pro-ArgB. Met-Leu-Lys-Met-ProC. Met-Leu-Lys-Met-Pro-stop-ArgD. Met-ProE. Pro-Met-Lys-Leu-Met


Based on the DNA strand below, and assuming the promoter for this gene is located to the left, which protein sequence below does this sequencecode for? (Assume that the first nucleotide is the start of the first codon)


A. Met-Leu-Lys-Met-Pro-Arg

B. Met-Leu-Lys-Met-Pro

C. Met-Leu-Lys-Met-Pro-stop-Arg

D. Met-Pro

E. Pro-Met-Lys-Leu-Met


The translation process makes use of codons that serve as reference for the corresponding amino acid sequence. As stated, the sequence shows the first nucleotide as the start of the first codon. Thus, this will only need a direct conversion to an mRNA transcript (i.e. the strand shown is not the remplate strand). Aside from the corresponding amino acids, the codons also code for two distinct signals: the start and the termination of the translation process. The start codon is AUG while the stop codons are UAG, UGA and UAA.

Solution BlurView Complete Written Solution