Translating the mRNA to its equivalent polypeptide chain uses a three-base sequence that corresponds to a single amino acid. This is the codon which is complementary to the anticodon of the tRNA that is carrying the amino acid.
Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid in this codon chart is designated by a single letter code. Use these letters to indicate the amino acid sequence below. The mRNA sequence is shown below:
AUGUACACAGCAAUCUCCGGAAGGGAGGCGACG
Frequently Asked Questions
What scientific concept do you need to know in order to solve this problem?
Our tutors have indicated that to solve this problem you will need to apply the Translation concept. You can view video lessons to learn Translation. Or if you need more Translation practice, you can also practice Translation practice problems.
What professor is this problem relevant for?
Based on our data, we think this problem is relevant for Professor Clegg's class at UIUC.