Problem: Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid  in this codon chart is designated by a single letter code. Use these letters to indicate the amino acid sequence below. The mRNA sequence is shown below:AUGUACACAGCAAUCUCCGGAAGGGAGGCGACG

🤓 Based on our data, we think this question is relevant for Professor Clegg's class at UIUC.

FREE Expert Solution

Translating the mRNA to its equivalent polypeptide chain uses a three-base sequence that corresponds to a single amino acid. This is the codon which is complementary to the anticodon of the tRNA that is carrying the amino acid. 

View Complete Written Solution
Problem Details

Translate the mRNA complementary copy of the gene into the final gene product: a protein. Note that each amino acid  in this codon chart is designated by a single letter code. Use these letters to indicate the amino acid sequence below. The mRNA sequence is shown below:

AUGUACACAGCAAUCUCCGGAAGGGAGGCGACG