Ch.5 - Biological MoleculesWorksheetSee all chapters
All Chapters
Ch.1 - Introduction to Biology
Ch.2 - Chemistry
Ch.3 - Water
Ch.4 - Carbon
Ch.5 - Biological Molecules
Ch.6 - Cells
Ch.7 - The Membrane
Ch.8 - Energy and Metabolism
Ch.9 - Respiration
Ch.10 - Photosynthesis
Ch.11 - Cell Signaling
Ch.12 - Cell Division
Ch.13 - Meiosis
Ch.14 - Mendelian Genetics
Ch.15 - Chromosomal Theory of Inheritance
Ch.16 - DNA Synthesis
Ch.17 - Gene Expression
Ch.18 - Regulation of Expression
Ch.19 - Viruses
Ch.20 - Biotechnology
Ch.21 - Genomics
Ch.22 - Development
Ch.23 - Evolution by Natural Selection
Ch.24 - Evolution of Populations
Ch.25 - Speciation
Ch.26 - History of Life on Earth
Ch.27 - Phylogeny
Ch.28 - Prokaryotes
Ch.29 - Protists
Ch.30 - Plants
Ch.31 - Fungi
Ch.32 - Overview of Animals
Ch.33 - Invertebrates
Ch.34 - Vertebrates
Ch.35 - Plant Anatomy
Ch.36 - Vascular Plant Transport
Ch.37 - Soil
Ch.38 - Plant Reproduction
Ch.39 - Plant Sensation and Response
Ch.40 - Animal Form and Function
Ch.41 - Digestive System
Ch.42 - Circulatory System
Ch.43 - Immune System
Ch.44 - Osmoregulation and Excretion
Ch.45 - Endocrine System
Ch.46 - Animal Reproduction
Ch.47 - Nervous System
Ch.48 - Sensory Systems
Ch.49 - Muscle Systems
Ch.50 - Ecology
Ch.51 - Animal Behavior
Ch.52 - Population Ecology
Ch.53 - Community Ecology
Ch.54 - Ecosystems
Ch.55 - Conservation Biology
Sections
Polymers
Carbohydrates
Proteins
Nucleic Acids
Lipids
Additional Practice
Cumulative Macromolecules

Concept #3: Secondary and Tertiary Structure

Practice: The three components of a nucleotide are:

-

-

-

Practice: Uracil is used in ___________ in place of _______________________.

Practice: Which of the following pieces of DNA is complementary to this one 5’-ATCGAGTGA-3’ ?

Practice: Which piece of DNA would required the most energy to pull apart?

Practice: What is the secondary structure of DNA called?

Additional Problems
If cytosine makes up 22% of the nucleotides in a DNA sample, then adenine would make up what percent of the bases? a. 33 b. 44 c. 28 d. 56 e. none of these answers are correct
If you have 56 total nucleotides and 13 are C, how many are G? a. 13 b. 15 c. 26 d. 30 e. none of these answers is correct.
If a double-stranded DNA sample were composed of 10% thymine, what would be the percentage of guanine? a. 10% b. 20% c. 40% d. 80%
A single strand of DNA contains the following sequence: 5'-GATTCGTCAACTG-3', the complementary single strand is: a. 3'-CUAAGCAGUUGAC-5' b. 3'-CTAAGCAGTTGAC-5' c. 5'-CTAAGCAGTTGAC-3' d. 5'-GUTTCGTCUUCGT-3' e. 3'-CATTCGTCAACTG-5'
Which of the following is not found in RNA? a. adenine b cytosine c. guanine d. thymine e. uracil
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'- CATAGGA- 3'
Which of the following DNA molecules is the most stable?a. 5'-CTGCATAC-3'    3'-GACGTATG-5'b. 5'-GAAATTTC-3'    3'-CTTTAAAG-5'c. 5'-AGTCGAAT-3'    3'-TCAGCTTA-5'd. 5'-GCGTGCAC-3'    3'-CGCACGTG-5'e. 5'-GGATCCTG-3'    3'-CCTAGGAC-5'
Which of the following statements about DNA and RNA is FALSE?a. DNA forms a double-stranded helical structure that contains base pairs whereas RNA is single stranded and does not form base pairs or adopt a double helical conformation.b. DNA and RNA are both synthesized in the 5' to 3' direction.c. DNA serves as the template for the synthesis of DNA during DNA replication and for RNA during transcription.d. The energy for both DNA and RNA synthesis comes from cleavage of phosphoanhydride bonds in the deoxynucleotide or nucleotide building blocks.e. DNA contains the bases A, G, C and T, whereas RNA contains the bases A, G, C and U.
DNA's sugar-phosphate backbones are joined with:  a. Ionic bonds b. Hydrogen bonds c. Weak chemical bonds d. Covalent bonds
Strands of DNA are joined by:  a. Hydrogen bonds b. Covalent bonds c. Ionic bonds d. Phosphodiester bond
The DNA nitrogen bases that are pyrimidines are:  a. Cytosine and guanine b. Uracil and cytosine c. Thymine and cytosine d. Thymine and adenine e. Uracil and thymine
The DNA nitrogen bases that are purines are:  a. Adenine and thymine b. Adenine and uracil c. Guanine and thymine d. Guanine and cytosine e. Adenine and guanine
Pyrimidine bases have a __________ __________ structure:  a. Single, ring b. Single, triangle c. Double, ring d. Double, triangle e. Triple, ring
Purine bases have a _________ ___________ structure: a. Single, ringb. Single, trianglec. Double, triangled. Double, ringe. Triple, ring
The 3' and 5' designations refer to the numbers that chemists assign to the:  a. Hydrogen atoms of deoxyribose b. Oxygen atoms of deoxyribose c. Carbon atoms in the nitrogen bases d. Nitrogen atoms in the nitrogen bases e. Carbon atoms of deoxyribose
How many phosphoester (phosphate ester) and phosphoanhydride bonds are in adenosine monophosphate (AMP) and adenosine triphosphate (ATP)?
Which of the following statements about DNA is  false? a. DNA contains deoxyribose as its sugar b. DNA contains the base thymine c. DNA is double-stranded d. DNA exists as an alpha-helix e. None of the above
Which of the following is not a component of nucleic acids? a. a five-carbon sugar b. a six-carbon sugar c. a phosphate group d. phosphodiester bonds e. an organic nitrogen containing base
What is the complementary DNA sequence to 5′ ATGCATCG 3′? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.If 5′ CGATGCAT 3′ is the template DNA strand, what is the sequence of the non-coding strand? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.If 5′ CGATGCAT 3′ is the template DNA strand, what is the sequence of the mRNA transcript? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.The template strand of a molecule of DNA contains 22%C, 18%G, 32%A, 28%T.a. What percentage of the non-template strand is C?b. What percentage of the RNA transcript is G?c. What percentage of the RNA transcript is T?
The twisted ladder of DNA is composed of building blocks called:  a. Amino acids b. Monosaccharides c. Phospholipids d. Disaccharides e. Nucleotides
The rungs of the DNA ladder:   a. Are formed by base pairs joined by covalent bonds b. Are formed by base pairs joined by hydrogen bonds c. Are formed by base pairs joined by phosphodiester bonds  
RNA differs from DNA in that:  a. RNA contains ribose b. RNA contains uracil c. All are correct d. RNA is usually single stranded e. RNA can catalyze chemical reactions
How are the monomers in nucleic acids joined?  a. Peptide bonds between carbohydrates b. Peptide bonds between amino acids c. Phosphodiester bonds between amino acids d. Peptide bonds between nucleotides e. Phosphodiester bonds between nucleotides  
What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.5' - TAAACAAAGAAGTACAACAA - 3'
A. Name the nucleotide.B. Draw the new chemical structure if a hydrolysis reaction were to occur with the nucleotide.
A. Name the sugarB. Label each carbonC. Determine the number of -OH groups in the sugar
According to Chargaff's rules, if a genome is 30% adenine, then what percentage of the genome should be thymine?A. 30%B. 35%C. 40%D. 20%E. 70%
Reduction of -OH at the C2 in D-ribose leads to the creation of _____ found in the sugar backbone of DNA.A. celluloseB. β-D-2-oxyriboseC. β-D-2-deoxyriboseD. Glucopyranose
The base compositions of samples of genomic DNA from several different animals were given below. Which samples are likely to come from the same species? HINT: You should be able to identify 2 species (i.e. 2 pairs of samples) from the given data. Assume that only A, T G, and C are present in the DNA samples.A. 27.3% TB. 29.5% GC. 13.1% CD. 36.9% AE. 22.7% CF. 19.9% T
If one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand?A. GACGTCAB. AGTACTGC. GTCATGAD. TCATGAC
You sequenced three DNA strands that are fragments of a single gene. Manually assemble the fragments and write down the complete (full) sequence.Fragment 1: 5' - CCATGTCAGGGA - 3'Fragment 2: 3' - TTAATTTAGGGA - 5'Fragment 3: 5' - TAACCCCCATG - 3'
Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat, which breaks hydrogen bonds?A. GGCGTACCAGCGCAT     CCGCATGGTCGCGTAB. ATACGATTTACGAGA    TATGCTAAATGCTCTExplain your choice.
Complete each of the following senteces by selecting the correct answer:A. Cytosine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).B. Deoxythymidine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).C. UMP is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).D. Guanine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).
Which of the following statements is TRUE?A. Histones are rich in the amino acids D and E, and interact with DNA via ionic bonds.B. RNA is transcribed as a double stranded biopolymer.C. Adenosine functions as a neuromodulator and is inhibited by caffeine.D. Propeller twist increases the area of contact between DNA bases and water.E. DNA double helical structure is stabilized by glycosidic bonds that hold the paire bases together.
The template strand of a given gene includes the sequence 3' - T G A T G T C C G A T T - 5'. What is the sequence of the non-template strand?A. 3' - A C T A C A G G C T A A  - 5'B. 3' - T T A G C C T G T A G T - 5'C. 5' - T G A T G T C C G A T T - 3'D. 5' - A C T A C A G G C T A A - 3'E. 5' - T T A G C C T G T A G T - 3'
Adenine makes up 22% of the nucleotides in a particular sample ofgenomic DNA. What percentage of the nucleotides in this sample are guanine?A. 18B. 22C. 28D. 32E. Can't tell from the information provided
Which of the following does not provide evidence to support the conclusion that nitrogenous bases pair in specific combinations?A. a purine-purine pair is too wide to account for the 2-nm diameter of the double helix.B. The sugar-phosphate backbone is held together by phosphodiester bonds.C. The X-ray data suggested that the double helix had a uniform diameter.D. Whenever one strand of DNA has a C, the partner strand has a G.E. A pyrimidine-pyrimidine pair is too narrow o account for the 2nm-diameter of the double helix.
Which of the following molecules is phosphate?
Which of the following molecules is ribose?
Which of the following is a nitrogenous base known as a purine?
Deduce whether each of the nucleic acid molecules in the table below is DNA or RNA, and single-stranded or double-stranded. Explain your reasoning.
What bonds form between complementary base pairs? Between a base and the deoxyribose sugar?
What is the complementary DNA strand of the sequence 5' - AGTCTGAC - 3'?
Chargaff's results yielded a molar ratio of 1.67 for A to G in yeast DNA, 1.92 for T to C, 1.03 for A to T, and 1.20 for G to C. The ratio of purines to pyrimidines is 1.00. Calculate the mole fractions of A, G, T, and C in yeast DNA.
The presence of a 2'-OH group indicates that the pentose sugar in a nucleotide is ______ while the absence of a 2'-OH group indicates the sugar in the nucleotide is _____.
Identify the key structural features of a DNA molecule. Mark all that apply: A. DNA strands are antiparallel and include a 5' end and a 3' end.B. Strong ionic bonds and hydrophobic interaction hold DNA together.C. DNA contains the nucleotide bases adenine, thymine, guanine, cytosine, and uracil.D. DNA is most often found as a left-handed helix, commonly referred to as Z-DNA.E. The backbone of DNA is made of a sugar and a phosphate molecule.F. DNA bases are always paired purine with pyrimidine.