Nucleic Acids

Concept: Nucleotides

6m

Concept: Nucleic Acids

11m

Concept: Secondary and Tertiary Structure

9m

Problem: The three components of a nucleotide are:

-

-

-

1m

Problem: Uracil is used in ___________ in place of _______________________.

1m

Problem: Which of the following pieces of DNA is complementary to this one 5’-ATCGAGTGA-3’ ?

1m

Problem: Which piece of DNA would required the most energy to pull apart?

1m

Problem: What is the secondary structure of DNA called?

1m

Nucleic Acids Additional Practice Problems

According to Chargaff's rules, if a genome is 30% adenine, then what percentage of the genome should be thymine?

A. 30%

B. 35%

C. 40%

D. 20%

E. 70%

Watch Solution

The template strand of a given gene includes the sequence 3' - T G A T G T C C G A T T - 5'. What is the sequence of the non-template strand?

A. 3' - A C T A C A G G C T A A  - 5'

B. 3' - T T A G C C T G T A G T - 5'

C. 5' - T G A T G T C C G A T T - 3'

D. 5' - A C T A C A G G C T A A - 3'

E. 5' - T T A G C C T G T A G T - 3'

Watch Solution

Which of the following does not provide evidence to support the conclusion that nitrogenous bases pair in specific combinations?

A. a purine-purine pair is too wide to account for the 2-nm diameter of the double helix.

B. The sugar-phosphate backbone is held together by phosphodiester bonds.

C. The X-ray data suggested that the double helix had a uniform diameter.

D. Whenever one strand of DNA has a C, the partner strand has a G.

E. A pyrimidine-pyrimidine pair is too narrow o account for the 2nm-diameter of the double helix.

Watch Solution

Adenine makes up 22% of the nucleotides in a particular sample ofgenomic DNA. What percentage of the nucleotides in this sample are guanine?

A. 18

B. 22

C. 28

D. 32

E. Can't tell from the information provided

Watch Solution

Reduction of -OH at the C2 in D-ribose leads to the creation of _____ found in the sugar backbone of DNA.

A. cellulose

B. β-D-2-oxyribose

C. β-D-2-deoxyribose

D. Glucopyranose

Watch Solution

A. Name the nucleotide.

B. Draw the new chemical structure if a hydrolysis reaction were to occur with the nucleotide.

Watch Solution

A. Name the sugar

B. Label each carbon

C. Determine the number of -OH groups in the sugar

Watch Solution

Chargaff's results yielded a molar ratio of 1.67 for A to G in yeast DNA, 1.92 for T to C, 1.03 for A to T, and 1.20 for G to C. The ratio of purines to pyrimidines is 1.00. Calculate the mole fractions of A, G, T, and C in yeast DNA.

Watch Solution

Deduce whether each of the nucleic acid molecules in the table below is DNA or RNA, and single-stranded or double-stranded. Explain your reasoning.

Watch Solution

The base compositions of samples of genomic DNA from several different animals were given below. Which samples are likely to come from the same species? HINT: You should be able to identify 2 species (i.e. 2 pairs of samples) from the given data. Assume that only A, T G, and C are present in the DNA samples.

A. 27.3% T

B. 29.5% G

C. 13.1% C

D. 36.9% A

E. 22.7% C

F. 19.9% T

Watch Solution

Complete each of the following senteces by selecting the correct answer:

A. Cytosine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).

B. Deoxythymidine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).

C. UMP is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).

D. Guanine is a (purine base / pyrimidine base / purine nucleoside / pyrimidine nucleoside / purine nucleotide / pyrimidine nucleotide).

Watch Solution

Which of the following statements is TRUE?

A. Histones are rich in the amino acids D and E, and interact with DNA via ionic bonds.

B. RNA is transcribed as a double stranded biopolymer.

C. Adenosine functions as a neuromodulator and is inhibited by caffeine.

D. Propeller twist increases the area of contact between DNA bases and water.

E. DNA double helical structure is stabilized by glycosidic bonds that hold the paire bases together.

Watch Solution

The presence of a 2'-OH group indicates that the pentose sugar in a nucleotide is ______ while the absence of a 2'-OH group indicates the sugar in the nucleotide is _____.

Watch Solution

You sequenced three DNA strands that are fragments of a single gene. Manually assemble the fragments and write down the complete (full) sequence.

Fragment 1: 5' - CCATGTCAGGGA - 3'

Fragment 2: 3' - TTAATTTAGGGA - 5'

Fragment 3: 5' - TAACCCCCATG - 3'

Watch Solution

What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.

5' - TAAACAAAGAAGTACAACAA - 3'

Watch Solution

What is the complementary DNA strand of the sequence 5' - AGTCTGAC - 3'?

Watch Solution

If one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand?

A. GACGTCA

B. AGTACTG

C. GTCATGA

D. TCATGAC

Watch Solution

Which of the following molecules is ribose?

Watch Solution

Which of the following molecules is phosphate?

Watch Solution

Which of the following is a nitrogenous base known as a purine?

Watch Solution

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat, which breaks hydrogen bonds?

A. GGCGTACCAGCGCAT

     CCGCATGGTCGCGTA


B. ATACGATTTACGAGA

    TATGCTAAATGCTCT


Explain your choice.

Watch Solution

Identify the key structural features of a DNA molecule. Mark all that apply: 

A. DNA strands are antiparallel and include a 5' end and a 3' end.

B. Strong ionic bonds and hydrophobic interaction hold DNA together.

C. DNA contains the nucleotide bases adenine, thymine, guanine, cytosine, and uracil.

D. DNA is most often found as a left-handed helix, commonly referred to as Z-DNA.

E. The backbone of DNA is made of a sugar and a phosphate molecule.

F. DNA bases are always paired purine with pyrimidine.

Watch Solution

Which of the following DNA molecules is the most stable?

a. 5'-CTGCATAC-3'
    3'-GACGTATG-5'

b. 5'-GAAATTTC-3'
    3'-CTTTAAAG-5'

c. 5'-AGTCGAAT-3'
    3'-TCAGCTTA-5'

d. 5'-GCGTGCAC-3'
    3'-CGCACGTG-5'

e. 5'-GGATCCTG-3'
    3'-CCTAGGAC-5'

Watch Solution


Watch Solution

What is the complementary DNA sequence to 5′ ATGCATCG 3′? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.


If 5′ CGATGCAT 3′ is the template DNA strand, what is the sequence of the non-coding strand? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.


If 5′ CGATGCAT 3′ is the template DNA strand, what is the sequence of the mRNA transcript? Enter only the nucleotides, and put your answer in the 5’ to 3’ direction.


The template strand of a molecule of DNA contains 22%C, 18%G, 32%A, 28%T.

a. What percentage of the non-template strand is C?

b. What percentage of the RNA transcript is G?

c. What percentage of the RNA transcript is T?

Watch Solution

Which of the following statements about DNA and RNA is FALSE?

a. DNA forms a double-stranded helical structure that contains base pairs whereas RNA is single stranded and does not form base pairs or adopt a double helical conformation.

b. DNA and RNA are both synthesized in the 5' to 3' direction.

c. DNA serves as the template for the synthesis of DNA during DNA replication and for RNA during transcription.

d. The energy for both DNA and RNA synthesis comes from cleavage of phosphoanhydride bonds in the deoxynucleotide or nucleotide building blocks.

e. DNA contains the bases A, G, C and T, whereas RNA contains the bases A, G, C and U.

Watch Solution

How many hydrogen bonds exist between this DNA strand and its complementary strand? 

5'- CATAGGA- 3'

Watch Solution

What bonds form between complementary base pairs? Between a base and the deoxyribose sugar?

Watch Solution

How many phosphoester (phosphate ester) and phosphoanhydride bonds are in adenosine monophosphate (AMP) and adenosine triphosphate (ATP)?

Watch Solution

How are the monomers in nucleic acids joined? 

a. Peptide bonds between carbohydrates

b. Peptide bonds between amino acids

c. Phosphodiester bonds between amino acids

d. Peptide bonds between nucleotides

e. Phosphodiester bonds between nucleotides

 

Watch Solution

RNA differs from DNA in that: 

a. RNA contains ribose

b. RNA contains uracil

c. All are correct

d. RNA is usually single stranded

e. RNA can catalyze chemical reactions

Watch Solution

The rungs of the DNA ladder:  

a. Are formed by base pairs joined by covalent bonds

b. Are formed by base pairs joined by hydrogen bonds

c. Are formed by base pairs joined by phosphodiester bonds

 

Watch Solution

The twisted ladder of DNA is composed of building blocks called: 

a. Amino acids

b. Monosaccharides

c. Phospholipids

d. Disaccharides

e. Nucleotides

Watch Solution

The 3' and 5' designations refer to the numbers that chemists assign to the: 

a. Hydrogen atoms of deoxyribose

b. Oxygen atoms of deoxyribose

c. Carbon atoms in the nitrogen bases

d. Nitrogen atoms in the nitrogen bases

e. Carbon atoms of deoxyribose

Watch Solution

Purine bases have a _________ ___________ structure: 

a. Single, ring

b. Single, triangle

c. Double, triangle

d. Double, ring

e. Triple, ring

Watch Solution

Pyrimidine bases have a __________ __________ structure: 

a. Single, ring

b. Single, triangle

c. Double, ring

d. Double, triangle

e. Triple, ring

Watch Solution

The DNA nitrogen bases that are purines are: 

a. Adenine and thymine

b. Adenine and uracil

c. Guanine and thymine

d. Guanine and cytosine

e. Adenine and guanine

Watch Solution

The DNA nitrogen bases that are pyrimidines are: 

a. Cytosine and guanine

b. Uracil and cytosine

c. Thymine and cytosine

d. Thymine and adenine

e. Uracil and thymine

Watch Solution

Strands of DNA are joined by: 

a. Hydrogen bonds

b. Covalent bonds

c. Ionic bonds

d. Phosphodiester bond

Watch Solution

DNA's sugar-phosphate backbones are joined with: 

a. Ionic bonds

b. Hydrogen bonds

c. Weak chemical bonds

d. Covalent bonds

Watch Solution

If you have 56 total nucleotides and 13 are C, how many are G?

a. 13

b. 15

c. 26

d. 30

e. none of these answers is correct.

Watch Solution

If cytosine makes up 22% of the nucleotides in a DNA sample, then adenine would make up what percent of the bases?

a. 33

b. 44

c. 28

d. 56

e. none of these answers are correct

Watch Solution

Which of the following is not found in RNA?

a. adenine

b cytosine

c. guanine

d. thymine

e. uracil

Watch Solution

Which of the following is not a component of nucleic acids?

a. a five-carbon sugar

b. a six-carbon sugar

c. a phosphate group

d. phosphodiester bonds

e. an organic nitrogen containing base

Watch Solution

If a double-stranded DNA sample were composed of 10% thymine, what would be the percentage of guanine?

a. 10%

b. 20%

c. 40%

d. 80%

Watch Solution

A single strand of DNA contains the following sequence: 5'-GATTCGTCAACTG-3', the complementary single strand is:

a. 3'-CUAAGCAGUUGAC-5'

b. 3'-CTAAGCAGTTGAC-5'

c. 5'-CTAAGCAGTTGAC-3'

d. 5'-GUTTCGTCUUCGT-3'

e. 3'-CATTCGTCAACTG-5'

Watch Solution

Which of the following statements about DNA is  false?

a. DNA contains deoxyribose as its sugar

b. DNA contains the base thymine

c. DNA is double-stranded

d. DNA exists as an alpha-helix

e. None of the above

Watch Solution