Ch.17 - Gene ExpressionSee all chapters
All Chapters
Ch.1 - Introduction to Biology
Ch.2 - Chemistry
Ch.3 - Water
Ch.4 - Carbon
Ch.5 - Biological Molecules
Ch.6 - Cells
Ch.7 - The Membrane
Ch.8 - Energy and Metabolism
Ch.9 - Respiration
Ch.10 - Photosynthesis
Ch.11 - Cell Signaling
Ch.12 - Cell Division
Ch.13 - Meiosis
Ch.14 - Mendelian Genetics
Ch.15 - Chromosomal Theory of Inheritance
Ch.16 - DNA Synthesis
Ch.17 - Gene Expression
Ch.18 - Regulation of Expression
Ch.19 - Viruses
Ch.20 - Biotechnology
Ch.21 - Genomics
Ch.22 - Development
Ch.23 - Evolution by Natural Selection
Ch.24 - Evolution of Populations
Ch.25 - Speciation
Ch.26 - History of Life on Earth
Ch.27 - Phylogeny
Ch.28 - Prokaryotes
Ch.29 - Protists
Ch.30 - Plants
Ch.31 - Fungi
Ch.32 - Overview of Animals
Ch.33 - Invertebrates
Ch.34 - Vertebrates
Ch.35 - Plant Anatomy
Ch.36 - Vascular Plant Transport
Ch.37 - Soil
Ch.38 - Plant Reproduction
Ch.39 - Plant Sensation and Response
Ch.40 - Animal Form and Function
Ch.41 - Digestive System
Ch.42 - Circulatory System
Ch.43 - Immune System
Ch.44 - Osmoregulation and Excretion
Ch.45 - Endocrine System
Ch.46 - Animal Reproduction
Ch.47 - Nervous System
Ch.48 - Sensory Systems
Ch.49 - Muscle Systems
Ch.50 - Ecology
Ch.51 - Animal Behavior
Ch.52 - Population Ecology
Ch.53 - Community Ecology
Ch.54 - Ecosystems
Ch.55 - Conservation Biology
Sections
Gene Expression and the Genetic Code
Transcription
RNA Processing
Translation
Mutation

Concept #1: Point Mutations

Concept #2: Frameshift Mutations and Chromosomal Mutations

Additional Problems
Base substitution mutations and frame-shift mutations: If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides: 5' - ACTACGTGA - 3' Sort the following replicated DNA sequences by the type of point mutation each contains (frame-shift, base substitution, or neither), as compared to the correct sequence shown above. Sort the items into the appropriate bins. 
What type of mutation has occurred in the following? Normal allele 5' – GGAAUGAAACAGGAACCC – 3' Mutant allele 5' – GGAAUGAAACAGGUACCC – 3'  a. Substitution b. Insertion of one base c. Deletion of one base d. Insertion of two bases e. Deletion of two bases
What type of mutation has occurred in the following? Normal allele 5' – GGAAUGAAACAGGAACCC – 3' Mutant allele 5' – GGAAUGAAAUCAGGAACCC – 3'  a. Insertion of one base b. Substitution c. Deletion of one base d. Insertion of two bases e. Deletion of two bases
Which mutation in DNA would lead to the change of a single amino acid in a protein?  a. A nonsense mutation b. A one base deletion c. A one base insertion d. A missense mutation e. A frameshift
Which point mutation would be most likely to have a catastrophic effect on the functioning of a protein? a. a base substitution b. a base deletion near the start of the coding sequence c. a base deletion near the end of the coding sequence, but not in the terminator codon d. deletion of three bases near the start of the coding sequence, but not in the initiator codon e. a base insertion near the end of the coding sequence, but not in the terminator codon
Translocation during meiosis is not a cause of mutation.  a. True b. False
A somatic mutation is a mutation that occurs in cells that give rise to gametes.  a. True b. False
Mutations may be caused by:  a. Errors in replication b. Exposure to radiation c. Exposure to chemicals d. Breakage of chromosomes e. All are correct
What would occur if a mutation caused an aminoacyl-tRNA synthetase to recognize both its normal amino acid and a different one?a. Translation would occur normally.b. All codons would be misread.c. One or more codons would sometimes be misread.d. One or more codons would always be misread.
Given the DNA sequences below of coding strands, identify and underline the mutation in each. What effect did each DNA mutation have on the final protein products. What type of mutation occurred (synonymous, non-synonymous, nonsense, nonstop)? Explain. Original DNA Sequence5’ – A T G T T T C T G G T C A A T T G C G C A G G T C C A A C C T A G – 3’Mutated Sequences:A. 5’ – A T G T T T T T G G T C A A T T G C G C A G G T C C A A C C T A G – 3’B. 5’ – A T G T T T G T G G T C A A T T G C G C A G G T C C A A C C T A G – 3’C. 5’ – A T G T T T C T G G T C A A T T G C G C A G G T C C A A C C T A A – 3’D. 5’ – A T G C T T T C T G G T C A A T T G C G C A G G T C C A A C C T A G – 3’E. 5’ – A T G T T T C T G G T C A A T T A G C G C A G G T C C A A C C T A G – 3’F. Which of the above mutations do you think would be more deleterious to the cell/organism? Explain your reasoning. 
Would a random mutation in a coding region of the genome or a random mutation that occurs during transcription/mRNA processing be worse for the cell/organism overall? Explain.
Which of the following mutations would be most likely to have a harmful effect on an organism?a. a deletion of three nucleotides near the middle of a geneb. a single nucleotide insertion downstream of, and close to, the start of the coding sequencec. a single nucleotide deletion near the end of the coding sequenced. a single nucleotide deletion in the middle of an introne. a base-pair substitution
In a "nonsense" mutation:  a. The codon that mutates does not cause a change in the amino acid specified b. The codon that mutates causes a change in the amino acid specified c. The codon that mutates causes a stop codon to occur instead of the placement of an amino acid d. The mutation does not occur in a codon e. The mutation is not in DNA
In a "missense" mutation:  a. The codon that mutates does not cause a change in the amino acid specified b. The codon that mutates causes a change in the amino acid specified c. The codon that mutates causes a stop codon to occur instead of the placement of an amino acid d. The mutation does not occur in a codon e. The mutation is not in DNA
In a "silent" mutation:  a. The codon that mutates causes a change in the amino acid specified b. The codon that mutates does not cause a change in the amino acid specified c. The codon that mutates causes a stop codon to occur instead of the placement of an amino acid d. The mutation does not occur in a codon e. The mutation is not in DNA
In a "frameshift" mutation:  a. The codon that mutates causes a change in the amino acid specified b. The codon that mutates causes a stop codon to occur instead of the placement of an amino acid c. The mutation does not occur in a codon d. May be caused by an addition or deletion of one or more nucleotides e. The mutation is not in DNA
Which of the following could NOT introduce a premature stop codon in mRNA?a. insertion of an incorrect nucleotide by RNA polymerase during transcriptionb. a mutation in the coding sequence within the DNAc. a mutation in the promoter sequence within the DNAd. a mistake during splicing that leads to retention of an intron
Label the four mutated DNA segments shown below according to the type of point mutation each represents. Use the codon table above to determine how each mutation would affect the amino acid coding for each segment. Drag the labels to their appropriate locations to identify the type of point mutation shown.        
Using the genetic code shown here, predict what type of mutation has occurred in the hemoglobin sickle cell anemia allele.Normal allele 5' – GGAAUGAAACAGGAACCC – 3'Mutant allele 5' – GGAAUGAAACAGGUACCC – 3' a. A point mutation, Val to Glub. A frame shiftc. Addition of a new stop codond. A point mutation, Glu to Val
Predict the potential effect of a particular point mutation on the structure and function of a protein.
Name the three types of base substitution mutations and list the consequence of each type?
Both nonsense mutations and frameshift mutations can cause mutant proteins to be shorter than normal. Explain how the same general type of effect on protein structure is caused by these two different types of mutations.
What type of mutation would be caused if two bases are deleted from the original DNA strand? What would happen to the protein?
Define "mutation" and describe its potential consequences.
What is a missense mutation?A. a mutation whose effect is not yet known.B. a mutation that changes a codon that specifies an amino acid to one that terminates translation.C. a mutation that changes a codon to a synonymous codon.D. a mutation that alters the reading frame of the gene.E. a mutation that results in a different amino acid in a protein.
Define the following:  a. Proband b. Penetrance c. Non-sense mutationd. Trisomy e. Homologous chromosomes 
For the given sequence 5' - GGAGCUCGUUGUAUU - 3'A. Is this sequence RNA or DNA? How can you tell?B. Which amino acids are encoded, if the reading frame is as shown, starting from the correct end?C. What would be the effect on the amino acid sequence if the sequence were changed to 5' GGAGACUCGUUGUAUU -3'? Explain why the amino acid sequence changes.
When a chromosome has either a duplication or a deletion, the chance that the mutation will be harmful are a function of:A. its location, if it occurs in a germ-line cell, it will be more harmful than if it occurs in a somatic cell.B. its size, the larger the duplication or deletion, the greater the chance of harm.C. its position on the chromosome, if it occurs at the tip of a long arm, it is likely to be less harmful than if it occurs at the tip of a short arm.D. None of the other answer options is correct.E. its size, the smaller the duplication or deletion, the greater the chance of harm.
What type of mutation would be caused if three bases were deleted from the original DNA strand? Would this cause an amino acid to be lost?
Explain why deletion of a single nucleotide in a gene generally results in more severe defects in the polypeptide than a point mutation that changes a single nucleotide.
If a G position becomes depurinated, during the next DNA replication, that position will probably be filled with _____, if the damage is not repaired.A. AB. TC. CD. Nothing and cause a deletion
Explain how errors in DNA replication can cause mutations.
Which type of mutation usually has the largest effect on protein structure? Explain why.A.  missenseB.  silentC. frameshift
Compare the consequences of germline mutations to somatic mutations.
A protein-coding gene is diagrammed below, with 4 exons (blue boxes) and 3 introns. A researcher has isolated four different mutant alleles of this gene, designated A, B, C, and D. Each of the alleles has a different four-basepair insertion; their locations within the gene are shown by the red triangles in the figure. Which insertion - A, B, C, or D - is likely to have the biggest effect on protein function? Explain.
The sequence below is for a wild type gene whose mutation leads to a condition of defective iron transport called hemochromatosis. In hemochromatosis, the highlighted cysteine (Cys, C) residue is mutated to a tyrosine (Tyr, Y) residue. The coding strand of DNA is shown in the sequence as well as the protein sequence in single letter symbols. Which of the following is the most likely mutation at the DNA level?DNA : gataaccttggctgtaccccccggggaagagcagagatatacgtgccaggtggagcaccc+2fr:      - I - - T - - L - - A - - V - - P - - P - - G - - E - - E - - Q - - R - - Y - - T - - C - - Q - - V - - E - - H - - P -A. UGU to UCUB. UGC to UUAC. UGC to UACD. TGC to TACE. TAC to TGC
Below is the active site of chymotrypsin. Which mutation would have a greater effect on protein function: replacing Asp102 with glutamine or glutamic acid? Why?
How might a mutation cause a change in protein function? Are there any instances when a mutation can result in no change to an organism? 
Describe how a mutation can lead to large scale changers in the structure of an organism.
Mutations that inactivate metabolic pathways are called _____ mutations.A. morphologicalB. biochemicalC. lethalD. conditional
How do splice-site mutations differ from nonsense mutations?
Which of the following is the best example of a missense mutation?A. Ala-Gln-Cys-Asp-Leu → Ala-GlnB. Ala-Gln-Cys-Asp-Leu → Ala-Gln-Cys-His-LeuC. Ala-Gln-Cys-Asp-Leu → Ala-Gln-Cys-His-LysD. Ala-Gln-Cys-Asp-Leu → Ala-Gln-Cys-Asp-Leu
Which of the following mutations, resulting in an error in the mRNA shortly after the start codon is likely to have the most serious effects on the polypeptide product?A. Deletion of a single codonB. Deletion of a single nucleotideC. Insertion of three nucleotidesD. Substitution of a single nucleotide
_____ radiation excites atoms to a higher energy state within molecules such as DNA, which leads to the formation of pyrimidine dimers.A. ParticleB. IonizingC. UltravioletD. InfraredE. Gamma
Describe four types of point mutations:transitions, transversions, deletions, and additions.
Explain why a point mutation in a gene may or may not cause a change in the primary sequence of a protein.
Why are point mutations in the third nucleotide of a codon less likely to cause the production of a non-functional protein? Is this also true for frameshift mutations? Why or why not?
In the strand below, a mutation occurs at the 8th nucleotide. The nucleotide is deleted. Transcribe then translate the strand to see what happens to the protein.original : 3' - TAG CTG AAT TGC AGT GCC ATC GATG - 5'mutated : 3' - TAG CTG ATT GCA TTG CCA TTG ATG - 5'
Since the two strands of the DNA molecule are complementary, for any given gene:A. The RNA polymerase can bind to either strand.B. Only one strand actually carries the genetic code for a particular gene.C. Each gene possesses an exact replica that can be used should a mutation occur.D. A gene transcribed in the 5' to 3' direction on one strand can be transcribed in the 3' to 5' direction on the other strand.
A random mutation event has lead to the deletion of a nucleotide within the translated region of a particular gene. How would the resulting protein be different from the unmutated for of the gene? Explain your answers in 2-3 sentences.
A single base substitution is LEAST likely to be deleterious (dangerous) when the change results in _____.A. the replacement of a codon specifying a hydrophilic amino acid with a codon that specifies a hydrophobic amino acid.B. the replacement of a codon specifying an amino acid with a stop codon.C. the substitution of an amino acid in the active site of the protein.D. the replacement of a codon specifying an amino acid with a different codon that specifies the same amino acid.
List four genes whose mutations are associated with cancer. For each gene briefly describe: 1) Their normal functions, including the related signaling pathways and cell behaviors; 2) Their oncogenic roles: the effects of their mutants to cell behaviors in cancers. (Tow genes whose coding proteins are closely associated with each other will only be counted as One.)
Mutations due to small insertions and deletions can arise spontaneously during DNA replication because:A. a purine in the template DNA strand mispairs with an incoming purine.B. guanine is depurinated.C. a purine in the template DNA strand mispairs with an incoming pyrimidine.D. strand slippage occursE. a tautomeric shift takes place so that cytosine in the new DNA strand is able to pair with an adenine in the template strand.
Which of the following statements are true about mutations at the 7q11.23?A. Some individuals with autism have extra copies of this genetic region.B. This genetic region has a big impact on social ability.C. Individuals who have a deletion at this genetic region have Williams-Beuren syndrome, a disease that makes people especially social and outgoing.D. This genetic region has been identified in all the autism children studied.
Deamination of 5-methylcytosine _____.A. converts that base to a uracilB. converts that base to a thymineC. happens mostly in RNAD. is an epigenetic mark
The mRNA sequence belowcodes for part of a protein. The reading frame for the translation of this mRNA starts with the first three nucleotides as shown.AUG-CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU Met   Arg   Ser   Glu   Pro   Arg    Asp   Lys   HisA. What would be the consequence of the insertion of an A after the third nucleotide of the sequence?B. What would be the consequence of the deletion of the C at the beginning of this sequence?
A ______ mutation is one that leads to premature insertion of a stop codon within an ORF.
UV radiation is a useful tool in producing mutants of microbial culturesA. TrueB. False
UV light damages DNA. What bases in the DNA specifically does it damage? What chemical changes that occur, or how does the physical structure of the DNA change? How do these changes kill cells?